Открыть главное меню

Гаплогруппа Q (Y-ДНК)

Гаплогруппа Q — Y-хромосомная гаплогруппа, распространённая у некоторых сибирских народов, а также у коренных американских народов, и, в некоторой степени — по всей Азии. Предполагается, что носителями данной (и других) гаплогруппы были имеющие сибирское происхождение гунны[1]. Встречается в южной Швеции, среди евреев-ашкеназов, и в некоторых районах Центральной и Восточной Европы (французские Альпы, южная Сицилия, южная Хорватия (на острове Хвар), Сербия, части Польши и Украины, часть северо-западной России с центром в Тверской области)[2].

Гаплогруппа Q
Haplogroup Q (Y-DNA).PNG
Время появления 20000—15000 лет до н.э.
Место появления Сибирь или Урал
Предковая группа Гаплогруппа P
Мутации-маркеры M242

Гаплогруппа Q образовалась от субклады P1 (M45), известной как K2b2a, гаплогруппы P (K2b2) 31,9 тыс. лет назад. Последний общий предок современных носителей гаплогруппы Q жил 29,600 лет назад (датировка по SNP-маркёрам (снипам), по данным компании YFull[3]).

Разделение гаплогруппы Q1 на субклады происходило в Сибири до Последнего ледникового максимума (до 15,3 тыс. л. н.). Дифференциация гаплогруппы Q-M242 на субклады происходила в Центральной Азии и Южной Сибири начиная с палеолита. Из 10 субветвей Q1, образовавшихся в Сибири, в миграции в Берингию участвовали 3 субветви (Q1b1a1b-L804, Q1-Z780 и Q1-M3), Америки достигли 2 субклада (Q1-Z780 и Q1-M3). Разделение Q1a1-F746/NWT01 на гаплогруппы Q1a1a-M120 (ISOGG 2018) и Q1a1b-B143 (ISOGG 2018) произошло ок. 15,25 тыс. лет назад. Гаплогруппа Q1b1a2-Z780 (ISOGG 2018) возникла ок. 15 тыс. л. н. и найдена исключительно в популяциях американских индейцев (из древних образцов к ней принадлежит образец Анзик-1 (Anzick-1) возрастом 12,7 тыс. л. н.). Гаплогруппы Q1b1a2-Z780 (ISOGG 2018) и Q1b1a1a-M3 (ISOGG 2018) претерпевают экспансию и разделение на субклады в Северной Америке примерно 15 тыс. лет назад[4][5]. Взрывообразный рост числа потомков основателя субклады Q1-M3 произошёл примерно 15 тыс. лет назад в Новом Свете, когда потомки мужчины-основателя группы стали очень быстро расселяться по огромным незаселённым просторам обеих Америк[6][7].

Этногеографическое распределениеПравить

В Евразии встречается в пределах треугольника с вершинами в Норвегии (для скандинавских стран типичен субклад Q1-M346), Иране и Монголии, но в основном среди всех этих народов встречается редко, однако значительна у малочисленных сибирских народов кетов и селькупов. Субклад Q1-M3 типичен для коренных американцев. Среди евреев-ашкеназов встречается субклад Q1b.

Центральная АзияПравить

Гаплогруппа Q доминирует у туркмен Каракалпакстана, туркмен Ирана, туркмен Афганистана[8]. У казахов встречается у рода Канглы (кангюй) — 48 %[9]-67,5 %[10] и кулан-кыпшаков — 46 %[9].


Чеченцы, принадлежащие к гаплогруппе Q, локализованы в составе тайпов Гордалой, Энгеной, Эгишбатой, Дишний и Шуоной, которые входят в тукхум Нохчмахкхой[11][12].


Детали M242:

Смена нуклеотидов: от C к T
Позиция: 180
Общая величина: 366
Вперёд 5′→ 3′: aactcttgataaaccgtgctg
Назад 5′→ 3′: tccaatctcaattcatgcctc

Известные представители гаплогруппы QПравить


  • Q1a1b-B143 определёна у образца Kolyma1 со стоянки Дуванный яр (9769 лет до настоящего времени)[14].
  • Гаплогруппа Q1a была обнаружена у представителя палеоэскимосской культуры Саккак, жившего в Гренландии ок. 4 тыс. лет назад[15].
  • У мальчика Анзик-1 (en:Anzick-1), жившего 12,6 тысяч лет назад на территории нынешнего штата Монтана, Y-хромосома относится к субкладе Q1a3a-L54*(xM3) (en:Haplogroup Q-L54)[16][17][18].
  • У образцов из бразильского Caverna do Sumidouro (Лагоа-Санта) возрастом более 10 тыс. л. н. определены Y-хромосомные гаплогруппы Q-L53, Q-M3 (xY4308), Q-M3 (M848)[19].
  • У образцов из бразильского Lapa do Santo возрастом ок. 9,5 тыс. л. н. определены субклады Q1a2a1a, Q1a2a1a1 и Q1a2a1b[20].
  • Субклад Q1a3a-M3 обнаружен у кенневикского человека, жившего 9300 лет назад[21].
  • Субклад Q1a2 обнаружен у мезолитического обитателя стоянки Звейниеки (Латвия)[22].
  • Субклад Q1a обнаружен у представителя хвалынской культуры, жившего 6700 лет назад[23].
  • Субклад Q1a3 обнаружен у обитателей позднего неолита—ранней бронзы стоянки Усть-Ида и обитателей ранней бронзы стоянки Курма XI в Прибайкалье[24].
  • Гаплогруппа Q обнаружена у двух мужчин из захоронения среднего бронзового века в Бертек 56 на плато Укок на Алтае[25].
  • Y-хромосомная гаплогруппа Q1a была обнаружена у представителя карасукской культуры[26].
  • Q1a1 определён у киммерийца черногоровской культуры[27].
  • Все четверо мужчин хунну из Pengyang в Северном Китае, жившие 2500 лет назад, оказались обладателями Y-хромосомной гаплогруппы Q (у всех субклад Q1a1a1-M120)[28][29].
  • У представителя усть-бельской культуры со стоянки Усть-Белая II в Иркутской области (4410 — 4100 лет до настоящего времени) и у древних алеутов с Алеутских островов (от 2320—1900 до 500—140 л. н.) определён субклад Q1a2a, у образца I1524 (1180—830 л. н.) из Уэлена (Чукотка) определён субклад Q1a2a1a1[30].
  • Субклад Q1a2a1a1-M3 обнаружен у трёх древних образцов из Патагонии и Огненной Земли[31].

См. такжеПравить

Y-хромосомный Адам
A00   A0   A1
    A1a   A1b
A1b1 BT
  B   CT
D   E C F
F1  F2  F3    GHIJK  
    G HIJK
I J LT (K1) K2
L (K1a)   T (K1b)       K2a/K2a1/NO/NO1 K2b
N O   K2b1     P (K2b2)/P1  
  S (K2b1a) M (K2b1b) Q R  


  1. Haplogroup Q (Y-DNA)
  2. Haplogroup Q (Y-chromosomal DNA) — Eupedia
  3. Q YTree
  4. Lan-Hai Wei et al. Paternal origin of Paleo-Indians in Siberia: insights from Y-chromosome sequences
  5. По пути в Америку остановка в Берингии была не слишком долгой
  6. Poznik et al. Punctuated bursts in human male demography inferred from 1,244 worldwide Y-chromosome sequences, 2016
  7. Генетики обнаружили пять древних отцов всего человечества
  8. Генофонд туркмен Каракалпакстана в контексте Центральной Азии
  9. 1 2 http://vigg.ru/fileadmin/user_upload/Dissertatsionnyy_sovet/Kandidatskie_dissertatsii/2017/Zhabagin/dissertacionnaja_rabota_Zhabagin_MK.pdf
  10. Molecular Genetic Analysis of Population Structure of the Great Zhuz Kazakh Tribal Union Based on Y-Chromosome Polymorphism | SpringerLink
  11. Гаплогруппа Q на Северном Кавказе (по данным полного секвенирования Y хромосомы) Гурьянов Владимир
  12. Гаплогруппа Q на Северном Кавказе (по данным полного секвенирования Y хромосомы) 1 Гурьянов Владимир 2016 c. 163
  13. Акчурин М. М. Родословные татарских князей из фонда Саровского монастыря // Этнологические исследования в Татарстане.- вып. V.- Казань, 2011.- С.118-153.
  14. The population history of northeastern Siberia since the Pleistocen
  15. Rasmussen, M. et al., «Ancient human gonome sequence of an extinct Palaeo-Eskimo». Nature 463: 757—762.
  16. Rasmussen M. et al. The genome of a Late Pleistocene human from a Clovis burial site in western Montana // Nature. 2014. V. 506. P. 225—229.
  17. Jennifer A. Raff, Deborah A. Bolnick. Palaeogenomics: Genetic roots of the first Americans // Nature. 2014. V. 506. P. 162—163.
  18. Элементы — новости науки: Геном доисторического мальчика показал, что современные индейцы — прямые потомки кловисских охотников на мамонтов
  19. J. Víctor Moreno-Mayar et al. Early human dispersals within the Americas, 2018
  20. Cosimo Posth et al. Reconstructing the Deep Population History of Central and South America, 2018
  21. The ancestry and affiliations of Kennewick Man /Nature (2015)
  22. Iain Mathieson et al. The Genomic History Of Southeastern Europe, 2017
  23. Iain Mathieson et al. Eight thousand years of natural selection in Europe, 2015
  24. Maternal and Paternal Polymorphisms in Prehistoric Siberian Populations of Lake Baikal (2015)
  25. Пилипенко А. С., Молодин В. И., Трапезов Р. О., Черданцев С. В., Журавлёв А. А. Молекулярно-генетический анализ останков людей из погребального комплекса эпохи бронзы Бертек-56 (II тыс. до н. э., Республика Алтай, Россия) // Археология, этнография и антропология Евразии. Том 44 № 4 2016 Архивная копия от 12 декабря 2016 на Wayback Machine
  26. Morten E. Allentoft et al. «Population genomics of Bronze Age Eurasia»
  27. Maja Krzewińska et al. Ancient genomes suggest the eastern Pontic-Caspian steppe as the source of western Iron Age nomads, 2018
  28. Ancient DNA from nomads in 2500-year-old archeological sites of Pengyang, Ningxia, China. Journal of Human Genetics, Feb 2010
  29. All 4 was analyzed as Q1a1a1-M120. Lihongjie, Y-Chromosome Genetic Diversity of the Ancient North Chinese populations, Jilin University-China (2012)
  30. Pavel Flegontov et al. Paleo-Eskimo genetic legacy across North America, 2017
  31. Constanza de la Fuente et al. Genomic insights into the origin and diversification of late maritime hunter-gatherers from the Chilean Patagonia, 2018
